ID: 1155755706

View in Genome Browser
Species Human (GRCh38)
Location 18:29492950-29492972
Sequence ATGTGTGAGTGCATTGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155755706_1155755714 30 Left 1155755706 18:29492950-29492972 CCAAGATCAATGCACTCACACAT No data
Right 1155755714 18:29493003-29493025 TTACATAGCAGAAGGCAGGAGGG No data
1155755706_1155755708 -9 Left 1155755706 18:29492950-29492972 CCAAGATCAATGCACTCACACAT No data
Right 1155755708 18:29492964-29492986 CTCACACATTTGGTCTGCTGAGG No data
1155755706_1155755712 26 Left 1155755706 18:29492950-29492972 CCAAGATCAATGCACTCACACAT No data
Right 1155755712 18:29492999-29493021 ATCTTTACATAGCAGAAGGCAGG No data
1155755706_1155755713 29 Left 1155755706 18:29492950-29492972 CCAAGATCAATGCACTCACACAT No data
Right 1155755713 18:29493002-29493024 TTTACATAGCAGAAGGCAGGAGG No data
1155755706_1155755711 22 Left 1155755706 18:29492950-29492972 CCAAGATCAATGCACTCACACAT No data
Right 1155755711 18:29492995-29493017 CTGCATCTTTACATAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155755706 Original CRISPR ATGTGTGAGTGCATTGATCT TGG (reversed) Intergenic
No off target data available for this crispr