ID: 1155772550

View in Genome Browser
Species Human (GRCh38)
Location 18:29720331-29720353
Sequence CTCTGGTTTTGTAGATGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155772550_1155772557 1 Left 1155772550 18:29720331-29720353 CCCTCTCATCTACAAAACCAGAG No data
Right 1155772557 18:29720355-29720377 CCATCTTAGAGAAAAGGGAGAGG No data
1155772550_1155772555 -4 Left 1155772550 18:29720331-29720353 CCCTCTCATCTACAAAACCAGAG No data
Right 1155772555 18:29720350-29720372 AGAGGCCATCTTAGAGAAAAGGG No data
1155772550_1155772558 13 Left 1155772550 18:29720331-29720353 CCCTCTCATCTACAAAACCAGAG No data
Right 1155772558 18:29720367-29720389 AAAGGGAGAGGAAAATAATCTGG No data
1155772550_1155772554 -5 Left 1155772550 18:29720331-29720353 CCCTCTCATCTACAAAACCAGAG No data
Right 1155772554 18:29720349-29720371 CAGAGGCCATCTTAGAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155772550 Original CRISPR CTCTGGTTTTGTAGATGAGA GGG (reversed) Intergenic
No off target data available for this crispr