ID: 1155774032

View in Genome Browser
Species Human (GRCh38)
Location 18:29736684-29736706
Sequence CTTTCAGAAGAAACTCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155774032_1155774033 -3 Left 1155774032 18:29736684-29736706 CCTTGCAGAGTTTCTTCTGAAAG No data
Right 1155774033 18:29736704-29736726 AAGATCCACTGTTAGCCTGATGG No data
1155774032_1155774036 12 Left 1155774032 18:29736684-29736706 CCTTGCAGAGTTTCTTCTGAAAG No data
Right 1155774036 18:29736719-29736741 CCTGATGGAGTTTCCTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155774032 Original CRISPR CTTTCAGAAGAAACTCTGCA AGG (reversed) Intergenic
No off target data available for this crispr