ID: 1155774125

View in Genome Browser
Species Human (GRCh38)
Location 18:29737550-29737572
Sequence CTGCTGGTAATGTGGCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155774119_1155774125 1 Left 1155774119 18:29737526-29737548 CCACTCATGTCCCTGTGCCTGTT No data
Right 1155774125 18:29737550-29737572 CTGCTGGTAATGTGGCAAAATGG No data
1155774121_1155774125 -9 Left 1155774121 18:29737536-29737558 CCCTGTGCCTGTTTCTGCTGGTA No data
Right 1155774125 18:29737550-29737572 CTGCTGGTAATGTGGCAAAATGG No data
1155774122_1155774125 -10 Left 1155774122 18:29737537-29737559 CCTGTGCCTGTTTCTGCTGGTAA No data
Right 1155774125 18:29737550-29737572 CTGCTGGTAATGTGGCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155774125 Original CRISPR CTGCTGGTAATGTGGCAAAA TGG Intergenic
No off target data available for this crispr