ID: 1155774810

View in Genome Browser
Species Human (GRCh38)
Location 18:29747449-29747471
Sequence TGGCCTCTTTTTGGATTTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155774810_1155774814 2 Left 1155774810 18:29747449-29747471 CCGTCAAATCCAAAAAGAGGCCA No data
Right 1155774814 18:29747474-29747496 GTGTGAGACGCTCCAGGAGATGG No data
1155774810_1155774812 -4 Left 1155774810 18:29747449-29747471 CCGTCAAATCCAAAAAGAGGCCA No data
Right 1155774812 18:29747468-29747490 GCCAAAGTGTGAGACGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155774810 Original CRISPR TGGCCTCTTTTTGGATTTGA CGG (reversed) Intergenic
No off target data available for this crispr