ID: 1155776288

View in Genome Browser
Species Human (GRCh38)
Location 18:29766222-29766244
Sequence TCTCCTCATCTGTGGACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155776286_1155776288 -9 Left 1155776286 18:29766208-29766230 CCTGGAGCAAAATTTCTCCTCAT No data
Right 1155776288 18:29766222-29766244 TCTCCTCATCTGTGGACCTGTGG No data
1155776285_1155776288 6 Left 1155776285 18:29766193-29766215 CCACTTCTGATTAATCCTGGAGC No data
Right 1155776288 18:29766222-29766244 TCTCCTCATCTGTGGACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155776288 Original CRISPR TCTCCTCATCTGTGGACCTG TGG Intergenic
No off target data available for this crispr