ID: 1155783366

View in Genome Browser
Species Human (GRCh38)
Location 18:29868350-29868372
Sequence GTGTGTGGGTATATGTATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155783361_1155783366 0 Left 1155783361 18:29868327-29868349 CCCAGCTTAATCAATAGGGGGTG No data
Right 1155783366 18:29868350-29868372 GTGTGTGGGTATATGTATCTAGG No data
1155783362_1155783366 -1 Left 1155783362 18:29868328-29868350 CCAGCTTAATCAATAGGGGGTGG No data
Right 1155783366 18:29868350-29868372 GTGTGTGGGTATATGTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155783366 Original CRISPR GTGTGTGGGTATATGTATCT AGG Intergenic
No off target data available for this crispr