ID: 1155784898

View in Genome Browser
Species Human (GRCh38)
Location 18:29884015-29884037
Sequence CTGTGTCAGCAGCATGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155784888_1155784898 15 Left 1155784888 18:29883977-29883999 CCCATAGAGTTAAACCCCTTGGC No data
Right 1155784898 18:29884015-29884037 CTGTGTCAGCAGCATGTGGCTGG No data
1155784892_1155784898 1 Left 1155784892 18:29883991-29884013 CCCCTTGGCCAGGTAAGAGGAAG No data
Right 1155784898 18:29884015-29884037 CTGTGTCAGCAGCATGTGGCTGG No data
1155784893_1155784898 0 Left 1155784893 18:29883992-29884014 CCCTTGGCCAGGTAAGAGGAAGG No data
Right 1155784898 18:29884015-29884037 CTGTGTCAGCAGCATGTGGCTGG No data
1155784895_1155784898 -1 Left 1155784895 18:29883993-29884015 CCTTGGCCAGGTAAGAGGAAGGC No data
Right 1155784898 18:29884015-29884037 CTGTGTCAGCAGCATGTGGCTGG No data
1155784896_1155784898 -7 Left 1155784896 18:29883999-29884021 CCAGGTAAGAGGAAGGCTGTGTC No data
Right 1155784898 18:29884015-29884037 CTGTGTCAGCAGCATGTGGCTGG No data
1155784889_1155784898 14 Left 1155784889 18:29883978-29884000 CCATAGAGTTAAACCCCTTGGCC No data
Right 1155784898 18:29884015-29884037 CTGTGTCAGCAGCATGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155784898 Original CRISPR CTGTGTCAGCAGCATGTGGC TGG Intergenic
No off target data available for this crispr