ID: 1155785227

View in Genome Browser
Species Human (GRCh38)
Location 18:29888876-29888898
Sequence TATGTAGGACCATCCACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155785227_1155785230 16 Left 1155785227 18:29888876-29888898 CCTTTTGTGGATGGTCCTACATA No data
Right 1155785230 18:29888915-29888937 TTGTATCTTCAACATTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155785227 Original CRISPR TATGTAGGACCATCCACAAA AGG (reversed) Intergenic
No off target data available for this crispr