ID: 1155788088

View in Genome Browser
Species Human (GRCh38)
Location 18:29927281-29927303
Sequence TTGTGGGTTTGGAGAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155788083_1155788088 15 Left 1155788083 18:29927243-29927265 CCTGAACATTTGAGTTTAAAAAG No data
Right 1155788088 18:29927281-29927303 TTGTGGGTTTGGAGAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155788088 Original CRISPR TTGTGGGTTTGGAGAGAAAA AGG Intergenic
No off target data available for this crispr