ID: 1155790223

View in Genome Browser
Species Human (GRCh38)
Location 18:29958022-29958044
Sequence TATGGTTGTTACGCAGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155790220_1155790223 29 Left 1155790220 18:29957970-29957992 CCTGATTATGAGAAGGAATAAAC No data
Right 1155790223 18:29958022-29958044 TATGGTTGTTACGCAGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155790223 Original CRISPR TATGGTTGTTACGCAGCTAC AGG Intergenic
No off target data available for this crispr