ID: 1155792757

View in Genome Browser
Species Human (GRCh38)
Location 18:29995471-29995493
Sequence AGGGAGCGCATAGTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155792746_1155792757 26 Left 1155792746 18:29995422-29995444 CCACCTCCTGGTTTCACCTGGTG No data
Right 1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG No data
1155792750_1155792757 10 Left 1155792750 18:29995438-29995460 CCTGGTGGCACTGAGAATCTGTG No data
Right 1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG No data
1155792749_1155792757 20 Left 1155792749 18:29995428-29995450 CCTGGTTTCACCTGGTGGCACTG No data
Right 1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG No data
1155792744_1155792757 29 Left 1155792744 18:29995419-29995441 CCTCCACCTCCTGGTTTCACCTG No data
Right 1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG No data
1155792748_1155792757 23 Left 1155792748 18:29995425-29995447 CCTCCTGGTTTCACCTGGTGGCA No data
Right 1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155792757 Original CRISPR AGGGAGCGCATAGTGACTGT GGG Intergenic
No off target data available for this crispr