ID: 1155793202

View in Genome Browser
Species Human (GRCh38)
Location 18:29999100-29999122
Sequence GTTGAGAAAACCAATGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155793199_1155793202 14 Left 1155793199 18:29999063-29999085 CCAGATTGAAGATATTCTGGTTA No data
Right 1155793202 18:29999100-29999122 GTTGAGAAAACCAATGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155793202 Original CRISPR GTTGAGAAAACCAATGAAGA CGG Intergenic
No off target data available for this crispr