ID: 1155794301

View in Genome Browser
Species Human (GRCh38)
Location 18:30015329-30015351
Sequence AGTTAAGCTTTGTACCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155794301_1155794303 25 Left 1155794301 18:30015329-30015351 CCACTGAGGTACAAAGCTTAACT No data
Right 1155794303 18:30015377-30015399 TATGTAGAAGTCAGTATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155794301 Original CRISPR AGTTAAGCTTTGTACCTCAG TGG (reversed) Intergenic
No off target data available for this crispr