ID: 1155795293

View in Genome Browser
Species Human (GRCh38)
Location 18:30027851-30027873
Sequence ATGAAGAAATGGAAAGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155795293_1155795295 6 Left 1155795293 18:30027851-30027873 CCTTTTGCTTTCCATTTCTTCAT No data
Right 1155795295 18:30027880-30027902 ATAGCATGCCTTCTATAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155795293 Original CRISPR ATGAAGAAATGGAAAGCAAA AGG (reversed) Intergenic
No off target data available for this crispr