ID: 1155799448

View in Genome Browser
Species Human (GRCh38)
Location 18:30082100-30082122
Sequence CTTGCAGCCAAGTGCCTCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155799448_1155799453 27 Left 1155799448 18:30082100-30082122 CCGAAGAGGCACTTGGCTGCAAG No data
Right 1155799453 18:30082150-30082172 TGTGAAGATGTAAGTATTGCTGG No data
1155799448_1155799450 -7 Left 1155799448 18:30082100-30082122 CCGAAGAGGCACTTGGCTGCAAG No data
Right 1155799450 18:30082116-30082138 CTGCAAGTAGAGGATGTTAATGG No data
1155799448_1155799454 28 Left 1155799448 18:30082100-30082122 CCGAAGAGGCACTTGGCTGCAAG No data
Right 1155799454 18:30082151-30082173 GTGAAGATGTAAGTATTGCTGGG No data
1155799448_1155799452 3 Left 1155799448 18:30082100-30082122 CCGAAGAGGCACTTGGCTGCAAG No data
Right 1155799452 18:30082126-30082148 AGGATGTTAATGGTGCTTCAGGG No data
1155799448_1155799451 2 Left 1155799448 18:30082100-30082122 CCGAAGAGGCACTTGGCTGCAAG No data
Right 1155799451 18:30082125-30082147 GAGGATGTTAATGGTGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155799448 Original CRISPR CTTGCAGCCAAGTGCCTCTT CGG (reversed) Intergenic
No off target data available for this crispr