ID: 1155799452

View in Genome Browser
Species Human (GRCh38)
Location 18:30082126-30082148
Sequence AGGATGTTAATGGTGCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155799448_1155799452 3 Left 1155799448 18:30082100-30082122 CCGAAGAGGCACTTGGCTGCAAG No data
Right 1155799452 18:30082126-30082148 AGGATGTTAATGGTGCTTCAGGG No data
1155799447_1155799452 4 Left 1155799447 18:30082099-30082121 CCCGAAGAGGCACTTGGCTGCAA No data
Right 1155799452 18:30082126-30082148 AGGATGTTAATGGTGCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155799452 Original CRISPR AGGATGTTAATGGTGCTTCA GGG Intergenic
No off target data available for this crispr