ID: 1155800763

View in Genome Browser
Species Human (GRCh38)
Location 18:30099884-30099906
Sequence GTCTGACCAAACCACACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155800763_1155800765 -1 Left 1155800763 18:30099884-30099906 CCCTGAGTGTGGTTTGGTCAGAC No data
Right 1155800765 18:30099906-30099928 CAATACAATCTTTAAAACATAGG No data
1155800763_1155800767 27 Left 1155800763 18:30099884-30099906 CCCTGAGTGTGGTTTGGTCAGAC No data
Right 1155800767 18:30099934-30099956 ACACACTAAAATTTCTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155800763 Original CRISPR GTCTGACCAAACCACACTCA GGG (reversed) Intergenic
No off target data available for this crispr