ID: 1155801276

View in Genome Browser
Species Human (GRCh38)
Location 18:30106855-30106877
Sequence GCTCCATTTTAACAAATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155801276_1155801278 -6 Left 1155801276 18:30106855-30106877 CCATAAATTTGTTAAAATGGAGC No data
Right 1155801278 18:30106872-30106894 TGGAGCCAGATATAGGTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155801276 Original CRISPR GCTCCATTTTAACAAATTTA TGG (reversed) Intergenic
No off target data available for this crispr