ID: 1155803424

View in Genome Browser
Species Human (GRCh38)
Location 18:30137294-30137316
Sequence ATGCCCTTTTAAAAGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155803423_1155803424 2 Left 1155803423 18:30137269-30137291 CCATGGAAAAAGGACATAACAAA No data
Right 1155803424 18:30137294-30137316 ATGCCCTTTTAAAAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155803424 Original CRISPR ATGCCCTTTTAAAAGAATGA AGG Intergenic
No off target data available for this crispr