ID: 1155804212

View in Genome Browser
Species Human (GRCh38)
Location 18:30145397-30145419
Sequence TGGCCTCTTTCTCGATTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155804212_1155804218 13 Left 1155804212 18:30145397-30145419 CCTGAAAATCGAGAAAGAGGCCA No data
Right 1155804218 18:30145433-30145455 GGTAGCAGTCACGTCAGACTGGG No data
1155804212_1155804214 -8 Left 1155804212 18:30145397-30145419 CCTGAAAATCGAGAAAGAGGCCA No data
Right 1155804214 18:30145412-30145434 AGAGGCCATCCGGATACTAACGG No data
1155804212_1155804217 12 Left 1155804212 18:30145397-30145419 CCTGAAAATCGAGAAAGAGGCCA No data
Right 1155804217 18:30145432-30145454 CGGTAGCAGTCACGTCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155804212 Original CRISPR TGGCCTCTTTCTCGATTTTC AGG (reversed) Intergenic
No off target data available for this crispr