ID: 1155808869

View in Genome Browser
Species Human (GRCh38)
Location 18:30206699-30206721
Sequence TCTGATATGGACAGGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155808869_1155808875 14 Left 1155808869 18:30206699-30206721 CCCTCTCTCCTGTCCATATCAGA No data
Right 1155808875 18:30206736-30206758 ACCTGGTCTCCACTGACATTAGG No data
1155808869_1155808881 27 Left 1155808869 18:30206699-30206721 CCCTCTCTCCTGTCCATATCAGA No data
Right 1155808881 18:30206749-30206771 TGACATTAGGCAGAGGGGCTTGG No data
1155808869_1155808879 22 Left 1155808869 18:30206699-30206721 CCCTCTCTCCTGTCCATATCAGA No data
Right 1155808879 18:30206744-30206766 TCCACTGACATTAGGCAGAGGGG No data
1155808869_1155808878 21 Left 1155808869 18:30206699-30206721 CCCTCTCTCCTGTCCATATCAGA No data
Right 1155808878 18:30206743-30206765 CTCCACTGACATTAGGCAGAGGG No data
1155808869_1155808877 20 Left 1155808869 18:30206699-30206721 CCCTCTCTCCTGTCCATATCAGA No data
Right 1155808877 18:30206742-30206764 TCTCCACTGACATTAGGCAGAGG No data
1155808869_1155808873 -3 Left 1155808869 18:30206699-30206721 CCCTCTCTCCTGTCCATATCAGA No data
Right 1155808873 18:30206719-30206741 AGAAGTGCAGACTCCTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155808869 Original CRISPR TCTGATATGGACAGGAGAGA GGG (reversed) Intergenic
No off target data available for this crispr