ID: 1155812386

View in Genome Browser
Species Human (GRCh38)
Location 18:30253548-30253570
Sequence TTGGCCTAGTAAGTAAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155812386_1155812390 27 Left 1155812386 18:30253548-30253570 CCATTGTTTACTTACTAGGCCAA No data
Right 1155812390 18:30253598-30253620 TTGCCACCCTTACCTCTACCAGG No data
1155812386_1155812388 3 Left 1155812386 18:30253548-30253570 CCATTGTTTACTTACTAGGCCAA No data
Right 1155812388 18:30253574-30253596 ATCCACTATGACAGTGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155812386 Original CRISPR TTGGCCTAGTAAGTAAACAA TGG (reversed) Intergenic
No off target data available for this crispr