ID: 1155819616

View in Genome Browser
Species Human (GRCh38)
Location 18:30358844-30358866
Sequence CCACATGGCAACATTTTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155819616_1155819621 28 Left 1155819616 18:30358844-30358866 CCTAGTAAAATGTTGCCATGTGG No data
Right 1155819621 18:30358895-30358917 TCTGATGTAAATGTGAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155819616 Original CRISPR CCACATGGCAACATTTTACT AGG (reversed) Intergenic
No off target data available for this crispr