ID: 1155819619

View in Genome Browser
Species Human (GRCh38)
Location 18:30358859-30358881
Sequence TGTCTTCCTGAATAGCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155819619_1155819622 25 Left 1155819619 18:30358859-30358881 CCATGTGGCTATTCAGGAAGACA No data
Right 1155819622 18:30358907-30358929 GTGAATTCAGGAATATAAAGTGG No data
1155819619_1155819623 26 Left 1155819619 18:30358859-30358881 CCATGTGGCTATTCAGGAAGACA No data
Right 1155819623 18:30358908-30358930 TGAATTCAGGAATATAAAGTGGG No data
1155819619_1155819621 13 Left 1155819619 18:30358859-30358881 CCATGTGGCTATTCAGGAAGACA No data
Right 1155819621 18:30358895-30358917 TCTGATGTAAATGTGAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155819619 Original CRISPR TGTCTTCCTGAATAGCCACA TGG (reversed) Intergenic
No off target data available for this crispr