ID: 1155819621

View in Genome Browser
Species Human (GRCh38)
Location 18:30358895-30358917
Sequence TCTGATGTAAATGTGAATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155819619_1155819621 13 Left 1155819619 18:30358859-30358881 CCATGTGGCTATTCAGGAAGACA No data
Right 1155819621 18:30358895-30358917 TCTGATGTAAATGTGAATTCAGG No data
1155819616_1155819621 28 Left 1155819616 18:30358844-30358866 CCTAGTAAAATGTTGCCATGTGG No data
Right 1155819621 18:30358895-30358917 TCTGATGTAAATGTGAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155819621 Original CRISPR TCTGATGTAAATGTGAATTC AGG Intergenic
No off target data available for this crispr