ID: 1155819622

View in Genome Browser
Species Human (GRCh38)
Location 18:30358907-30358929
Sequence GTGAATTCAGGAATATAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155819619_1155819622 25 Left 1155819619 18:30358859-30358881 CCATGTGGCTATTCAGGAAGACA No data
Right 1155819622 18:30358907-30358929 GTGAATTCAGGAATATAAAGTGG No data
1155819620_1155819622 -6 Left 1155819620 18:30358890-30358912 CCTAATCTGATGTAAATGTGAAT No data
Right 1155819622 18:30358907-30358929 GTGAATTCAGGAATATAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155819622 Original CRISPR GTGAATTCAGGAATATAAAG TGG Intergenic
No off target data available for this crispr