ID: 1155822829

View in Genome Browser
Species Human (GRCh38)
Location 18:30399550-30399572
Sequence CAGGGTGCCCAGATATTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155822824_1155822829 15 Left 1155822824 18:30399512-30399534 CCTGTGTCTGAGTCACATATGTC No data
Right 1155822829 18:30399550-30399572 CAGGGTGCCCAGATATTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155822829 Original CRISPR CAGGGTGCCCAGATATTTTA AGG Intergenic
No off target data available for this crispr