ID: 1155823518

View in Genome Browser
Species Human (GRCh38)
Location 18:30408708-30408730
Sequence TCCCTATGTTTAGGAAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155823518_1155823521 8 Left 1155823518 18:30408708-30408730 CCAGCACTTCCTAAACATAGGGA No data
Right 1155823521 18:30408739-30408761 ACTAATTTTCCTCTCTCTTATGG No data
1155823518_1155823522 15 Left 1155823518 18:30408708-30408730 CCAGCACTTCCTAAACATAGGGA No data
Right 1155823522 18:30408746-30408768 TTCCTCTCTCTTATGGTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155823518 Original CRISPR TCCCTATGTTTAGGAAGTGC TGG (reversed) Intergenic
No off target data available for this crispr