ID: 1155824178

View in Genome Browser
Species Human (GRCh38)
Location 18:30418345-30418367
Sequence AATCTGTATTAAAATTACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155824178_1155824184 21 Left 1155824178 18:30418345-30418367 CCCAGGTAATTTTAATACAGATT No data
Right 1155824184 18:30418389-30418411 ACACACTGCCATTTGGGAATTGG No data
1155824178_1155824183 15 Left 1155824178 18:30418345-30418367 CCCAGGTAATTTTAATACAGATT No data
Right 1155824183 18:30418383-30418405 TTTGAGACACACTGCCATTTGGG No data
1155824178_1155824182 14 Left 1155824178 18:30418345-30418367 CCCAGGTAATTTTAATACAGATT No data
Right 1155824182 18:30418382-30418404 TTTTGAGACACACTGCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155824178 Original CRISPR AATCTGTATTAAAATTACCT GGG (reversed) Intergenic
No off target data available for this crispr