ID: 1155824179

View in Genome Browser
Species Human (GRCh38)
Location 18:30418346-30418368
Sequence CAATCTGTATTAAAATTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155824179_1155824183 14 Left 1155824179 18:30418346-30418368 CCAGGTAATTTTAATACAGATTG No data
Right 1155824183 18:30418383-30418405 TTTGAGACACACTGCCATTTGGG No data
1155824179_1155824182 13 Left 1155824179 18:30418346-30418368 CCAGGTAATTTTAATACAGATTG No data
Right 1155824182 18:30418382-30418404 TTTTGAGACACACTGCCATTTGG No data
1155824179_1155824184 20 Left 1155824179 18:30418346-30418368 CCAGGTAATTTTAATACAGATTG No data
Right 1155824184 18:30418389-30418411 ACACACTGCCATTTGGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155824179 Original CRISPR CAATCTGTATTAAAATTACC TGG (reversed) Intergenic
No off target data available for this crispr