ID: 1155824183

View in Genome Browser
Species Human (GRCh38)
Location 18:30418383-30418405
Sequence TTTGAGACACACTGCCATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155824179_1155824183 14 Left 1155824179 18:30418346-30418368 CCAGGTAATTTTAATACAGATTG No data
Right 1155824183 18:30418383-30418405 TTTGAGACACACTGCCATTTGGG No data
1155824177_1155824183 16 Left 1155824177 18:30418344-30418366 CCCCAGGTAATTTTAATACAGAT No data
Right 1155824183 18:30418383-30418405 TTTGAGACACACTGCCATTTGGG No data
1155824178_1155824183 15 Left 1155824178 18:30418345-30418367 CCCAGGTAATTTTAATACAGATT No data
Right 1155824183 18:30418383-30418405 TTTGAGACACACTGCCATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155824183 Original CRISPR TTTGAGACACACTGCCATTT GGG Intergenic
No off target data available for this crispr