ID: 1155829353

View in Genome Browser
Species Human (GRCh38)
Location 18:30493359-30493381
Sequence TGATGCTAATAGACTGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155829353_1155829357 -2 Left 1155829353 18:30493359-30493381 CCCAAATCAGTCTATTAGCATCA No data
Right 1155829357 18:30493380-30493402 CATTCTGGAAGCTCAGTTTTGGG No data
1155829353_1155829356 -3 Left 1155829353 18:30493359-30493381 CCCAAATCAGTCTATTAGCATCA No data
Right 1155829356 18:30493379-30493401 TCATTCTGGAAGCTCAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155829353 Original CRISPR TGATGCTAATAGACTGATTT GGG (reversed) Intergenic
No off target data available for this crispr