ID: 1155830223

View in Genome Browser
Species Human (GRCh38)
Location 18:30507666-30507688
Sequence CCTGCAAAGGAGCTGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155830223_1155830230 7 Left 1155830223 18:30507666-30507688 CCCTCCATCAGCTCCTTTGCAGG No data
Right 1155830230 18:30507696-30507718 CATTGGTCAAGTACAAAGCCAGG No data
1155830223_1155830231 13 Left 1155830223 18:30507666-30507688 CCCTCCATCAGCTCCTTTGCAGG No data
Right 1155830231 18:30507702-30507724 TCAAGTACAAAGCCAGGAAAAGG No data
1155830223_1155830228 -10 Left 1155830223 18:30507666-30507688 CCCTCCATCAGCTCCTTTGCAGG No data
Right 1155830228 18:30507679-30507701 CCTTTGCAGGTACTTTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155830223 Original CRISPR CCTGCAAAGGAGCTGATGGA GGG (reversed) Intergenic
No off target data available for this crispr