ID: 1155830420

View in Genome Browser
Species Human (GRCh38)
Location 18:30509908-30509930
Sequence CTATCTAATGGGTTGGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155830420_1155830424 -5 Left 1155830420 18:30509908-30509930 CCATCAACCAACCCATTAGATAG No data
Right 1155830424 18:30509926-30509948 GATAGTATAGATATTTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155830420 Original CRISPR CTATCTAATGGGTTGGTTGA TGG (reversed) Intergenic
No off target data available for this crispr