ID: 1155830424

View in Genome Browser
Species Human (GRCh38)
Location 18:30509926-30509948
Sequence GATAGTATAGATATTTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155830415_1155830424 27 Left 1155830415 18:30509876-30509898 CCACCTTGAAATTTTCTTTTCAA No data
Right 1155830424 18:30509926-30509948 GATAGTATAGATATTTTCCTTGG No data
1155830417_1155830424 24 Left 1155830417 18:30509879-30509901 CCTTGAAATTTTCTTTTCAAGGG No data
Right 1155830424 18:30509926-30509948 GATAGTATAGATATTTTCCTTGG No data
1155830419_1155830424 -4 Left 1155830419 18:30509907-30509929 CCCATCAACCAACCCATTAGATA No data
Right 1155830424 18:30509926-30509948 GATAGTATAGATATTTTCCTTGG No data
1155830420_1155830424 -5 Left 1155830420 18:30509908-30509930 CCATCAACCAACCCATTAGATAG No data
Right 1155830424 18:30509926-30509948 GATAGTATAGATATTTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155830424 Original CRISPR GATAGTATAGATATTTTCCT TGG Intergenic
No off target data available for this crispr