ID: 1155839441

View in Genome Browser
Species Human (GRCh38)
Location 18:30628553-30628575
Sequence AAAGGATGACTGGTGTGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155839441_1155839445 18 Left 1155839441 18:30628553-30628575 CCGAGGCACACCAGTCATCCTTT No data
Right 1155839445 18:30628594-30628616 TTACTTAGTCTACAGGCTGCAGG No data
1155839441_1155839446 19 Left 1155839441 18:30628553-30628575 CCGAGGCACACCAGTCATCCTTT No data
Right 1155839446 18:30628595-30628617 TACTTAGTCTACAGGCTGCAGGG No data
1155839441_1155839444 11 Left 1155839441 18:30628553-30628575 CCGAGGCACACCAGTCATCCTTT No data
Right 1155839444 18:30628587-30628609 AAGCTTCTTACTTAGTCTACAGG No data
1155839441_1155839448 30 Left 1155839441 18:30628553-30628575 CCGAGGCACACCAGTCATCCTTT No data
Right 1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG No data
1155839441_1155839447 23 Left 1155839441 18:30628553-30628575 CCGAGGCACACCAGTCATCCTTT No data
Right 1155839447 18:30628599-30628621 TAGTCTACAGGCTGCAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155839441 Original CRISPR AAAGGATGACTGGTGTGCCT CGG (reversed) Intergenic
No off target data available for this crispr