ID: 1155839443

View in Genome Browser
Species Human (GRCh38)
Location 18:30628571-30628593
Sequence GAAGCTTGATTACTAGCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155839443_1155839444 -7 Left 1155839443 18:30628571-30628593 CCTTTAGCTAGTAATCAAGCTTC No data
Right 1155839444 18:30628587-30628609 AAGCTTCTTACTTAGTCTACAGG No data
1155839443_1155839446 1 Left 1155839443 18:30628571-30628593 CCTTTAGCTAGTAATCAAGCTTC No data
Right 1155839446 18:30628595-30628617 TACTTAGTCTACAGGCTGCAGGG No data
1155839443_1155839450 18 Left 1155839443 18:30628571-30628593 CCTTTAGCTAGTAATCAAGCTTC No data
Right 1155839450 18:30628612-30628634 GCAGGGCTGGACCTCGGGCCTGG No data
1155839443_1155839447 5 Left 1155839443 18:30628571-30628593 CCTTTAGCTAGTAATCAAGCTTC No data
Right 1155839447 18:30628599-30628621 TAGTCTACAGGCTGCAGGGCTGG No data
1155839443_1155839448 12 Left 1155839443 18:30628571-30628593 CCTTTAGCTAGTAATCAAGCTTC No data
Right 1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG No data
1155839443_1155839451 19 Left 1155839443 18:30628571-30628593 CCTTTAGCTAGTAATCAAGCTTC No data
Right 1155839451 18:30628613-30628635 CAGGGCTGGACCTCGGGCCTGGG No data
1155839443_1155839445 0 Left 1155839443 18:30628571-30628593 CCTTTAGCTAGTAATCAAGCTTC No data
Right 1155839445 18:30628594-30628616 TTACTTAGTCTACAGGCTGCAGG No data
1155839443_1155839449 13 Left 1155839443 18:30628571-30628593 CCTTTAGCTAGTAATCAAGCTTC No data
Right 1155839449 18:30628607-30628629 AGGCTGCAGGGCTGGACCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155839443 Original CRISPR GAAGCTTGATTACTAGCTAA AGG (reversed) Intergenic
No off target data available for this crispr