ID: 1155839448

View in Genome Browser
Species Human (GRCh38)
Location 18:30628606-30628628
Sequence CAGGCTGCAGGGCTGGACCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155839443_1155839448 12 Left 1155839443 18:30628571-30628593 CCTTTAGCTAGTAATCAAGCTTC No data
Right 1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG No data
1155839442_1155839448 20 Left 1155839442 18:30628563-30628585 CCAGTCATCCTTTAGCTAGTAAT No data
Right 1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG No data
1155839441_1155839448 30 Left 1155839441 18:30628553-30628575 CCGAGGCACACCAGTCATCCTTT No data
Right 1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155839448 Original CRISPR CAGGCTGCAGGGCTGGACCT CGG Intergenic
No off target data available for this crispr