ID: 1155842231

View in Genome Browser
Species Human (GRCh38)
Location 18:30659800-30659822
Sequence GCTTACTTCTGTACTCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155842231_1155842233 -9 Left 1155842231 18:30659800-30659822 CCAGCAAGAGTACAGAAGTAAGC No data
Right 1155842233 18:30659814-30659836 GAAGTAAGCTGAGGCTGAAGTGG No data
1155842231_1155842236 22 Left 1155842231 18:30659800-30659822 CCAGCAAGAGTACAGAAGTAAGC No data
Right 1155842236 18:30659845-30659867 ACAAAGTAGGCTTCAGAAGGTGG 0: 2
1: 17
2: 82
3: 1216
4: 1383
1155842231_1155842235 19 Left 1155842231 18:30659800-30659822 CCAGCAAGAGTACAGAAGTAAGC No data
Right 1155842235 18:30659842-30659864 TTGACAAAGTAGGCTTCAGAAGG 0: 2
1: 14
2: 20
3: 31
4: 351
1155842231_1155842234 9 Left 1155842231 18:30659800-30659822 CCAGCAAGAGTACAGAAGTAAGC No data
Right 1155842234 18:30659832-30659854 AGTGGCTGAATTGACAAAGTAGG No data
1155842231_1155842237 23 Left 1155842231 18:30659800-30659822 CCAGCAAGAGTACAGAAGTAAGC No data
Right 1155842237 18:30659846-30659868 CAAAGTAGGCTTCAGAAGGTGGG 0: 7
1: 72
2: 1542
3: 1437
4: 883

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155842231 Original CRISPR GCTTACTTCTGTACTCTTGC TGG (reversed) Intergenic
No off target data available for this crispr