ID: 1155844255

View in Genome Browser
Species Human (GRCh38)
Location 18:30685548-30685570
Sequence GAATGACATAGTTGTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155844255_1155844257 29 Left 1155844255 18:30685548-30685570 CCAGCTGCACAACTATGTCATTC No data
Right 1155844257 18:30685600-30685622 CTTCCAATCCCCAGATTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155844255 Original CRISPR GAATGACATAGTTGTGCAGC TGG (reversed) Intergenic