ID: 1155844256

View in Genome Browser
Species Human (GRCh38)
Location 18:30685584-30685606
Sequence TTGGAAGTTTCTGAGTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155844256_1155844257 -7 Left 1155844256 18:30685584-30685606 CCATCAAACTCAGAAACTTCCAA No data
Right 1155844257 18:30685600-30685622 CTTCCAATCCCCAGATTGCCAGG No data
1155844256_1155844263 21 Left 1155844256 18:30685584-30685606 CCATCAAACTCAGAAACTTCCAA No data
Right 1155844263 18:30685628-30685650 ATCCAAGTATAATACCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155844256 Original CRISPR TTGGAAGTTTCTGAGTTTGA TGG (reversed) Intergenic
No off target data available for this crispr