ID: 1155844257

View in Genome Browser
Species Human (GRCh38)
Location 18:30685600-30685622
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155844256_1155844257 -7 Left 1155844256 18:30685584-30685606 CCATCAAACTCAGAAACTTCCAA No data
Right 1155844257 18:30685600-30685622 CTTCCAATCCCCAGATTGCCAGG No data
1155844255_1155844257 29 Left 1155844255 18:30685548-30685570 CCAGCTGCACAACTATGTCATTC No data
Right 1155844257 18:30685600-30685622 CTTCCAATCCCCAGATTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155844257 Original CRISPR CTTCCAATCCCCAGATTGCC AGG Intergenic