ID: 1155848344 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:30737261-30737283 |
| Sequence | CAGGCCTTTAAACTACACCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1155848344_1155848348 | 1 | Left | 1155848344 | 18:30737261-30737283 | CCATGGTGTAGTTTAAAGGCCTG | No data | ||
| Right | 1155848348 | 18:30737285-30737307 | GGGCTTGAAGACTGATGATGTGG | No data | ||||
| 1155848344_1155848349 | 22 | Left | 1155848344 | 18:30737261-30737283 | CCATGGTGTAGTTTAAAGGCCTG | No data | ||
| Right | 1155848349 | 18:30737306-30737328 | GGATTTCAGCCTGAATCTGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1155848344 | Original CRISPR | CAGGCCTTTAAACTACACCA TGG (reversed) | Intergenic | ||