ID: 1155848344

View in Genome Browser
Species Human (GRCh38)
Location 18:30737261-30737283
Sequence CAGGCCTTTAAACTACACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155848344_1155848348 1 Left 1155848344 18:30737261-30737283 CCATGGTGTAGTTTAAAGGCCTG No data
Right 1155848348 18:30737285-30737307 GGGCTTGAAGACTGATGATGTGG No data
1155848344_1155848349 22 Left 1155848344 18:30737261-30737283 CCATGGTGTAGTTTAAAGGCCTG No data
Right 1155848349 18:30737306-30737328 GGATTTCAGCCTGAATCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155848344 Original CRISPR CAGGCCTTTAAACTACACCA TGG (reversed) Intergenic