ID: 1155848347

View in Genome Browser
Species Human (GRCh38)
Location 18:30737280-30737302
Sequence TCATCAGTCTTCAAGCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155848347_1155848351 16 Left 1155848347 18:30737280-30737302 CCTGAGGGCTTGAAGACTGATGA No data
Right 1155848351 18:30737319-30737341 AATCTGCAGGCCTGAGAGCCAGG No data
1155848347_1155848353 18 Left 1155848347 18:30737280-30737302 CCTGAGGGCTTGAAGACTGATGA No data
Right 1155848353 18:30737321-30737343 TCTGCAGGCCTGAGAGCCAGGGG No data
1155848347_1155848352 17 Left 1155848347 18:30737280-30737302 CCTGAGGGCTTGAAGACTGATGA No data
Right 1155848352 18:30737320-30737342 ATCTGCAGGCCTGAGAGCCAGGG No data
1155848347_1155848349 3 Left 1155848347 18:30737280-30737302 CCTGAGGGCTTGAAGACTGATGA No data
Right 1155848349 18:30737306-30737328 GGATTTCAGCCTGAATCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155848347 Original CRISPR TCATCAGTCTTCAAGCCCTC AGG (reversed) Intergenic