ID: 1155848349

View in Genome Browser
Species Human (GRCh38)
Location 18:30737306-30737328
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155848344_1155848349 22 Left 1155848344 18:30737261-30737283 CCATGGTGTAGTTTAAAGGCCTG No data
Right 1155848349 18:30737306-30737328 GGATTTCAGCCTGAATCTGCAGG No data
1155848347_1155848349 3 Left 1155848347 18:30737280-30737302 CCTGAGGGCTTGAAGACTGATGA No data
Right 1155848349 18:30737306-30737328 GGATTTCAGCCTGAATCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155848349 Original CRISPR GGATTTCAGCCTGAATCTGC AGG Intergenic
No off target data available for this crispr