ID: 1155852817

View in Genome Browser
Species Human (GRCh38)
Location 18:30793748-30793770
Sequence CTGTGAAAGAGGCATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155852817_1155852824 15 Left 1155852817 18:30793748-30793770 CCATCCACATGCCTCTTTCACAG No data
Right 1155852824 18:30793786-30793808 TCTTCCAAACTTTATCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155852817 Original CRISPR CTGTGAAAGAGGCATGTGGA TGG (reversed) Intergenic
No off target data available for this crispr