ID: 1155857432

View in Genome Browser
Species Human (GRCh38)
Location 18:30850569-30850591
Sequence GAGGGCAAGCAGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155857432_1155857441 24 Left 1155857432 18:30850569-30850591 CCATCCTGCTTCTGCTTGCCCTC No data
Right 1155857441 18:30850616-30850638 TAGTACCAGTGAGTTGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155857432 Original CRISPR GAGGGCAAGCAGAAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr