ID: 1155857441

View in Genome Browser
Species Human (GRCh38)
Location 18:30850616-30850638
Sequence TAGTACCAGTGAGTTGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155857431_1155857441 25 Left 1155857431 18:30850568-30850590 CCCATCCTGCTTCTGCTTGCCCT No data
Right 1155857441 18:30850616-30850638 TAGTACCAGTGAGTTGAACCAGG No data
1155857438_1155857441 -10 Left 1155857438 18:30850603-30850625 CCCACTGTCCAACTAGTACCAGT No data
Right 1155857441 18:30850616-30850638 TAGTACCAGTGAGTTGAACCAGG No data
1155857436_1155857441 6 Left 1155857436 18:30850587-30850609 CCCTCTGTGGGCTGCACCCACTG 0: 360
1: 628
2: 956
3: 647
4: 577
Right 1155857441 18:30850616-30850638 TAGTACCAGTGAGTTGAACCAGG No data
1155857432_1155857441 24 Left 1155857432 18:30850569-30850591 CCATCCTGCTTCTGCTTGCCCTC No data
Right 1155857441 18:30850616-30850638 TAGTACCAGTGAGTTGAACCAGG No data
1155857433_1155857441 20 Left 1155857433 18:30850573-30850595 CCTGCTTCTGCTTGCCCTCTGTG 0: 39
1: 114
2: 362
3: 691
4: 1471
Right 1155857441 18:30850616-30850638 TAGTACCAGTGAGTTGAACCAGG No data
1155857437_1155857441 5 Left 1155857437 18:30850588-30850610 CCTCTGTGGGCTGCACCCACTGT 0: 351
1: 601
2: 921
3: 663
4: 526
Right 1155857441 18:30850616-30850638 TAGTACCAGTGAGTTGAACCAGG No data
1155857430_1155857441 26 Left 1155857430 18:30850567-30850589 CCCCATCCTGCTTCTGCTTGCCC No data
Right 1155857441 18:30850616-30850638 TAGTACCAGTGAGTTGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155857441 Original CRISPR TAGTACCAGTGAGTTGAACC AGG Intergenic
No off target data available for this crispr