ID: 1155864337

View in Genome Browser
Species Human (GRCh38)
Location 18:30945762-30945784
Sequence ATCTCAGAGTCGGGGCACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155864337_1155864342 4 Left 1155864337 18:30945762-30945784 CCTCGGTGCCCCGACTCTGAGAT No data
Right 1155864342 18:30945789-30945811 ATGAGAGACTGAATCCACAAAGG No data
1155864337_1155864344 12 Left 1155864337 18:30945762-30945784 CCTCGGTGCCCCGACTCTGAGAT No data
Right 1155864344 18:30945797-30945819 CTGAATCCACAAAGGGATAGTGG No data
1155864337_1155864343 5 Left 1155864337 18:30945762-30945784 CCTCGGTGCCCCGACTCTGAGAT No data
Right 1155864343 18:30945790-30945812 TGAGAGACTGAATCCACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155864337 Original CRISPR ATCTCAGAGTCGGGGCACCG AGG (reversed) Intergenic
No off target data available for this crispr